Top » Catalog » J2 » CTS6061

$18.00

CTS6061
[CTS6061]

CTS6061
hg38 Position: ChrY:14532164..14532164
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2a (not listed)
Comments: Downstream L70
Forward Primer: CTS6061_F GGCTGATTCACAGGAGCTATG
Reverse Primer: CTS6061_R CATCTGGAGCAAGACCACAG
Reviews

Customers who bought this product also purchased
FGC21085
FGC21085
Z40772
Z40772
M137
M137
PH2725
PH2725
FGC24630
FGC24630
FGC32683
FGC32683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16247
1 x M184
$36.00
Haplogroup Info
Other products
Currencies