Top » Catalog » J2 » FGC15782

$18.00

FGC15782
[FGC15782]

FGC15782
hg38 Position: ChrY:6804338..6804338
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Approx. L267
Forward Primer: FGC15782_F CACAATGTCCAGATAAGATGGC
Reverse Primer: FGC15782_R ATAGGGTCTTCCTCAGTTGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
1 x L27
1 x M137
1 x Y7292
1 x Y13626
$198.00
Haplogroup Info
Other products
Currencies