Top » Catalog » J2 » Y947

$18.00

Y947
[Y947]

Y947
hg38 Position: ChrY:2859919..2859919
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: downstream of Y950
Forward Primer: Y947_F GTGATTTATACACCTTTGTGATCTAGG
Reverse Primer: Y947_R CCTCCACTCCCACGAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y12378
1 x FGC35418
1 x Y14435
1 x A19099
1 x HU226
1 x Y7706
1 x CTS8204
$126.00
Haplogroup Info
Other products
Currencies