Top » Catalog » J2 » Y958

$18.00

Y958
[Y958]

Y958
hg38 Position: ChrY:6822851..6822851
Ancestral: G
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: downstream of Z2433. parallel to Y950
Forward Primer: Y958_F TTCATATGTATGTTGCTCATTTGTG
Reverse Primer: Y958_R CCAAACACTTATGGCTAAATGATG
Reviews

Customers who bought this product also purchased
Z8316
Z8316
Z2437
Z2437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16313
1 x FGC47760
1 x Y14568
1 x Y11782
1 x CTS494
1 x Y15052
$108.00
Haplogroup Info
Other products
Currencies