Top » Catalog » J2 » Y2163

$18.00

Y2163
[Y2163]

Y2163
hg38 Position: ChrY:15806415..15806415
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Found from public sources
Forward Primer: Y2163_F CTGCCTGTTTAGAGGAGTTGG
Reverse Primer: Y2163_R CCACAGTAGTAATGACTGTGGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies