Top » Catalog » J2 » Y965

$18.00

Y965
[Y965]

Y965
hg38 Position: ChrY:10048821..10048821
Ancestral: G
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Found from public sources
Forward Primer: Y965_F GATGAACCGAATGGTGGG
Reverse Primer: Y965_R CATTTGAGTTCCTGTATTAGGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY181167
$18.00
Haplogroup Info
Other products
Currencies