Top » Catalog » J2 » Y998

$18.00

Y998
[Y998]

Y998
hg38 Position: ChrY:20015876..20015876
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Found from public sources
Forward Primer: Y998_F AGGCCTTTCCCATGTTTTTC
Reverse Primer: Y998_R GGAGCAGAATCAGGAAGCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
$72.00
Haplogroup Info
Other products
Currencies