Top » Catalog » J2 » Y69955

$19.00

Y69955
[Y69955]

Y69955
hg38 Position: ChrY:14348387..14348387
Ancestral: G
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: J2b-L283>Z4133
Comments: J2b-L283
Forward Primer: Y69955_F CAAAACTCAGAACATAGCCCTG
Reverse Primer: Y69955_R TGCTTTTCTAAAGAGAGAGAGAGACC
Reviews

Customers who bought this product also purchased
L283
L283
CTS3617
CTS3617
BY54938
BY54938
J2b-M12 Panel
J2b-M12 Panel
Z34473
Z34473
BY103159
BY103159
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies