Top » Catalog » J2 » L84

$18.00

L84
[L84]

L84
hg38 Position: ChrY:19589210..19589210
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream of L24
Forward Primer: L84_F GCTTAGCAGATCATCCCAAAAC
Reverse Primer: L84_R GGCTGAAATCAATCCAATCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15895
$18.00
Haplogroup Info
Other products
Currencies