Top » Catalog » J2 » FGC16628

$18.00

FGC16628
[FGC16628]

FGC16628
hg38 Position: ChrY:19954902..19954902
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below Z7700 > L363 > A5834
Forward Primer: FGC16628_F ATTTTGGCTCAACCGTGTTC
Reverse Primer: FGC16628_R ACCCATTTCCACATGGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19193
1 x PF5273
1 x PH3120
1 x Y17030
1 x L363
1 x Y21460
1 x PF5060
1 x FGC32607
1 x PH1080
1 x SK1399
1 x SK1340
1 x FGC45340
1 x FGC5879
$234.00
Haplogroup Info
Other products
Currencies