Top » Catalog » J2 » FGC9962

$18.00

FGC9962
[FGC9962]

FGC9962
hg38 Position: ChrY:20967332..20967332
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9961 > FGC9927
Forward Primer: FGC9962_F CACATACCTTCTTGGGAAACAC
Reverse Primer: FGC9962_R CACATGAGGGTACCAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16141
1 x BZ3140
1 x FGC14165
$54.00
Haplogroup Info
Other products
Currencies