Top » Catalog » J2 » FGC9962

$18.00

FGC9962
[FGC9962]

FGC9962
hg38 Position: ChrY:20967332..20967332
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9961 > FGC9927
Forward Primer: FGC9962_F CACATACCTTCTTGGGAAACAC
Reverse Primer: FGC9962_R CACATGAGGGTACCAACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21091
1 x FGC17782
1 x Y14569
1 x FGC35458
1 x BY32808
1 x Y7694
1 x HU206
1 x FGC20419
1 x A19101
1 x A23313
1 x A19151
1 x FGC35491
1 x A15511
1 x Y20306
1 x SK1382
1 x S12459
1 x A12379
1 x BY183038
1 x SK1356
1 x FT4776
$360.00
Haplogroup Info
Other products
Currencies