Top » Catalog » J2 » FGC9966

$18.00

FGC9966
[FGC9966]

FGC9966
hg38 Position: ChrY:21203962..21203962
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below Z7700 > L363 > A5834
Forward Primer: FGC9966_F CTCTGTGCAGGTCCGTCTG
Reverse Primer: FGC9966_R AATATGGAAAGACCCACATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19130
$18.00
Haplogroup Info
Other products
Currencies