Top » Catalog » J2 » F3369

$18.00

F3369
[F3369]

F3369
hg38 Position: ChrY:20753612..20753612
Ancestral: T
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: F3369_F TCCATGCAGAGTCAGCTGTG
Reverse Primer: F3369_R TGCTCCTTAAAACAACTCCACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y7298
1 x A19270
1 x Page34
1 x CLD33
1 x Y16907
1 x FGC7379
1 x A6231
1 x FGC32591
$144.00
Haplogroup Info
Other products
Currencies