Top » Catalog » J2 » FGC9927

$18.00

FGC9927
[FGC9927]

FGC9927
hg38 Position: ChrY:13689551..13689551
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: FGC9927_F CATGTAAAATAAAGTTCCACCATTTC
Reverse Primer: FGC9927_R GGCTGAGGCGGACAATTG
Reviews

Customers who bought this product also purchased
PF5197
PF5197
FGC32723
FGC32723
J2-M172 Superclade Panel
J2-M172 Superclade Panel
L24
L24
L363
L363
Z2227
Z2227
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies