Top » Catalog » J2 » FGC9927

$18.00

FGC9927
[FGC9927]

FGC9927
hg38 Position: ChrY:13689551..13689551
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: FGC9927_F CATGTAAAATAAAGTTCCACCATTTC
Reverse Primer: FGC9927_R GGCTGAGGCGGACAATTG
Reviews

Customers who bought this product also purchased
FGC32723
FGC32723
J2-M172 Superclade Panel
J2-M172 Superclade Panel
L24
L24
L363
L363
Z2227
Z2227
Z7706
Z7706
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12375
1 x FGC9883
1 x FGC6735
1 x A19158
1 x A24020
1 x A23495
1 x MF10466
1 x Y18216
1 x FT84003
1 x FGC32512
1 x FGC15901
1 x Y18548
1 x FGC50114
1 x BY183679
1 x BY183199
1 x M340
1 x FGC86496
1 x SK1401
$324.00
Haplogroup Info
Other products
Currencies