Top » Catalog » J2 » FGC9927

$18.00

FGC9927
[FGC9927]

FGC9927
hg38 Position: ChrY:13689551..13689551
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: FGC9927_F CATGTAAAATAAAGTTCCACCATTTC
Reverse Primer: FGC9927_R GGCTGAGGCGGACAATTG
Reviews

Customers who bought this product also purchased
Z2222
Z2222
Z7700
Z7700
Y30061
Y30061
PF5088
PF5088
L25
L25
Y29713
Y29713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x F4326
$18.00
Haplogroup Info
Other products
Currencies