Top » Catalog » J2 » FGC9927

$18.00

FGC9927
[FGC9927]

FGC9927
hg38 Position: ChrY:13689551..13689551
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942 > FGC9961
Forward Primer: FGC9927_F CATGTAAAATAAAGTTCCACCATTTC
Reverse Primer: FGC9927_R GGCTGAGGCGGACAATTG
Reviews

Customers who bought this product also purchased
Z40168
Z40168
Y140109
Y140109
FGC9942
FGC9942
PF5709
PF5709
A5360
A5360
BY38021
BY38021
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies