Top » Catalog » J2 » FGC9942

$18.00

FGC9942
[FGC9942]

FGC9942
hg38 Position: ChrY:16576360..16576360
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9883
Forward Primer: FGC9942_F TGCATTCAAGGGCACATTG
Reverse Primer: FGC9942_R AACTTAAAATTTGGCAAATGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A24031
$18.00
Haplogroup Info
Other products
Currencies