Top » Catalog » J2 » FGC9942

$18.00

FGC9942
[FGC9942]

FGC9942
hg38 Position: ChrY:16576360..16576360
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9883
Forward Primer: FGC9942_F TGCATTCAAGGGCACATTG
Reverse Primer: FGC9942_R AACTTAAAATTTGGCAAATGTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15895
1 x Y20053
1 x Y13343
1 x PF7372
1 x A12380
1 x A24025
1 x A19150
1 x FGC35464
1 x A22122
1 x A16362
1 x PF7381
1 x FGC4993
1 x Y15234
1 x PF4908
1 x L317
1 x A516
1 x FGC5934
1 x SK1344
1 x FGC45341
1 x A19118
1 x L398
1 x HU223
1 x FGC6724
1 x PF5316
1 x BY45499
$450.00
Haplogroup Info
Other products
Currencies