Top » Catalog » J2 » FGC9961

$18.00

FGC9961
[FGC9961]

FGC9961
hg38 Position: ChrY:20960738..20960738
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942
Forward Primer: FGC9961_F TCTTGCCAGAGGAAAGAAGG
Reverse Primer: FGC9961_R AAAAGAACCTTGGTTTCCAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15508
1 x S9519
1 x Y13656
1 x Y21525
1 x Y16944
1 x SK1385
1 x Y20316
1 x HU208
1 x S19231
1 x Y15175
1 x Y14703
1 x Y15196
1 x SK1312
1 x L433
1 x A25273
1 x FGC85544
1 x Y23382
1 x PH4306
1 x SK1404
1 x A19170
1 x CTS12
1 x FGC32762
1 x Y15609
1 x PH180
1 x PF5345
1 x M47
1 x PH1553
$486.00
Haplogroup Info
Other products
Currencies