Top » Catalog » J2 » FGC9961

$18.00

FGC9961
[FGC9961]

FGC9961
hg38 Position: ChrY:20960738..20960738
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below L25 > Z7700 > FGC9942
Forward Primer: FGC9961_F TCTTGCCAGAGGAAAGAAGG
Reverse Primer: FGC9961_R AAAAGAACCTTGGTTTCCAAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies