Top » Catalog » J2 » M318

$18.00

M318
[M318]

M318
hg38 Position: ChrY:20583107..20583107
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: J2a1h2a1b
Comments: Below L25 > L70 > Z435
Forward Primer: M318_F TGGTCTTGACTCAGATGTTAATGC
Reverse Primer: M318_R TCATGGGAACCTTGAACTCC
Reviews

Customers who bought this product also purchased
FGC6724
FGC6724
Z421
Z421
FGC52112
FGC52112
Z39282
Z39282
CTS6061
CTS6061
Z2177
Z2177
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y16823
1 x Y3636
1 x L229
$54.00
Haplogroup Info
Other products
Currencies