Top » Catalog » J2 » L317

$18.00

L317
[L317]

L317
hg38 Position: ChrY:15404196..15404196
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Below Z7700 > FGC9961 > Z33772
Forward Primer: L317_F GGGGTTAGGGTATGTTTGTGTG
Reverse Primer: L317_R TGATATTCCTGCCTACCTATTAGTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
1 x FGC5948
1 x FGC5977
1 x Y9406
1 x AMM116
1 x Y13637
1 x Y993
1 x Y6958
1 x BY18375
1 x BY32799
1 x Y15222
1 x Y16907
1 x A23312
1 x Y19681
1 x M205
1 x F4168
1 x Y948
1 x A12376
1 x Y12582
1 x FGC32714
1 x Y9396
1 x FGC5978
1 x Y14713
1 x BY45498
$432.00
Haplogroup Info
Other products
Currencies