Top » Catalog » J2 » A516

$18.00

A516
[A516]

A516
hg38 Position: ChrY:13814762..13814762
Ancestral: T
Derived: G
Reference: Naeim Al-Suwaidi (2014)
ISOGG Haplogroup: J2a1h2 (not listed)
Comments: Found in a L25+ F3133+ Z7704+ L363+ person
Forward Primer: A516_F CTATGCTCTCAGAAGTGTACCTCTTG
Reverse Primer: A516_R GAGAACCATACCCGGAATACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FT69031
1 x Y16821
1 x Y4036
1 x FGC32615
1 x Y15245
1 x CTS6521
1 x Y12605
1 x Y966
1 x Y13534
1 x Y14715
1 x Y14594
$198.00
Haplogroup Info
Other products
Currencies