Top » Catalog » J2 » PF5294

$18.00

PF5294
[PF5294]

PF5294
hg38 Position: ChrY:12615510..12615510
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a1a2 (not listed)
Comments: Below L25 / S399
Forward Primer: PF5294_F TTTAGGAGAGATGGGGTTTCAC
Reverse Primer: PF5294_R TGTGCTACTTAAACCTTGCTATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies