Top » Catalog » J2 » PF5401

$18.00

PF5401
[PF5401]

PF5401
hg38 Position: ChrY:21834808..21834808
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a1a2a (not listed)
Comments: Below L25 / S399
Forward Primer: PF5401_F AACGGACTTCGGGTATGTCA
Reverse Primer: PF5401_R GGTGTGTTTCTGAAGGTACTTTC
Reviews

Customers who bought this product also purchased
FGC30343
FGC30343
Z38707
Z38707
L243
L243
FGC35461
FGC35461
Z38816
Z38816
Y162888
Y162888
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies