Top » Catalog » J2 » PF5401

$18.00

PF5401
[PF5401]

PF5401
hg38 Position: ChrY:21834808..21834808
Ancestral: C
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2a1a1a1a2a (not listed)
Comments: Below L25 / S399
Forward Primer: PF5401_F AACGGACTTCGGGTATGTCA
Reverse Primer: PF5401_R GGTGTGTTTCTGAAGGTACTTTC
Reviews

Customers who bought this product also purchased
FGC21085
FGC21085
Z40772
Z40772
L70
L70
J2a-L24 Panel
J2a-L24 Panel
Z435
Z435
FGC6735
FGC6735
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies