Top » Catalog » J2 » FGC5878

$18.00

FGC5878
[FGC5878]

FGC5878
hg38 Position: ChrY:3291264..3291264
Ancestral: G
Derived: A
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5878_F TGGGAGTTTTCCTACATCAGTG
Reverse Primer: FGC5878_R TCCCCTCCATCATGTCTTTG
Reviews

Customers who bought this product also purchased
PF5383
PF5383
FGC5879
FGC5879
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y15167
1 x Y13630
1 x Y13137
1 x L397
$72.00
Haplogroup Info
Other products
Currencies