Top » Catalog » J2 » FGC5879

$18.00

FGC5879
[FGC5879]

FGC5879
hg38 Position: ChrY:3329050..3329050
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5879v2_F TGAGAAAAATTGTAATATCAAGTGTCTGA
Reverse Primer: FGC5879v2_R CGTACTCAGTGAAAACAATGCG
Reviews

Customers who bought this product also purchased
FGC5878
FGC5878
PF5383
PF5383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
1 x A20725
1 x S18115
1 x A23499
1 x FGC32599
1 x SK1386
1 x Y15187
1 x A19085
1 x PH2350
$468.00
Haplogroup Info
Other products
Currencies