Top » Catalog » J2 » FGC5879

$18.00

FGC5879
[FGC5879]

FGC5879
hg38 Position: ChrY:3329050..3329050
Ancestral: A
Derived: G
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Found in a J2-L229 person
Forward Primer: FGC5879v2_F TGAGAAAAATTGTAATATCAAGTGTCTGA
Reverse Primer: FGC5879v2_R CGTACTCAGTGAAAACAATGCG
Reviews

Customers who bought this product also purchased
PF5383
PF5383
FGC5878
FGC5878
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies