Top » Catalog » J2 » CTS6804

$18.00

CTS6804
[CTS6804]

CTS6804
hg38 Position: ChrY:15004769..15004769
Ancestral: G
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream CTS900 CTS3261
Forward Primer: CTS6804_F TGCCCATATACCCATATCATTTC
Reverse Primer: CTS6804_R GCTAACCTGTTTCATGTCAACC
Reviews

Customers who bought this product also purchased
Y13654
Y13654
S12459
S12459
Y11202
Y11202
Z467
Z467
Y25813
Y25813
Y13640
Y13640
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y22040
1 x FGC20423
1 x Y7008
1 x Y15174
1 x SK1321
1 x L70
1 x Y25798
1 x Y24698
1 x FGC32603
$162.00
Haplogroup Info
Other products
Currencies