Top » Catalog » J2 » FGC15901

$18.00

FGC15901
[FGC15901]

FGC15901
hg38 Position: ChrY:19016398..19016398
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC15901_F CTCAGCACCCAGACAGACAC
Reverse Primer: FGC15901_R TAGGTTCATGTTGCCAGTGC
Reviews

Customers who bought this product also purchased
Z6065
Z6065
Z7553
Z7553
J2-M172 Superclade Panel
J2-M172 Superclade Panel
M67
M67
Z7503
Z7503
ZS7528
ZS7528
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies