Top » Catalog » J2 » FGC15901

$18.00

FGC15901
[FGC15901]

FGC15901
hg38 Position: ChrY:19016398..19016398
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC15901_F CTCAGCACCCAGACAGACAC
Reverse Primer: FGC15901_R TAGGTTCATGTTGCCAGTGC
Reviews

Customers who bought this product also purchased
Z7503
Z7503
ZS7528
ZS7528
PF5197
PF5197
Y7708
Y7708
L24
L24
Z7532
Z7532
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13616
1 x PF5065
1 x PF7357
1 x Y16958
1 x FGC35461
1 x M166
1 x Y12620
1 x A19149
1 x Y965
1 x FGC20439
1 x M241
1 x HU168
1 x Y20196
1 x FGC5898
1 x FGC17664
1 x Y6964
1 x FGC32684
$306.00
Haplogroup Info
Other products
Currencies