Top » Catalog » J2 » S12459

$18.00

S12459
[S12459]

S12459
hg38 Position: ChrY:9924848..9924848
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream Z7671
Forward Primer: S12459_F ATCTGGTAGTTTACTGCTGGAAAATAAGCTG
Reverse Primer: S12459_R CAACAGTAAACTATTGGACAAATATGTC
Reviews

Customers who bought this product also purchased
Z7671
Z7671
Y25813
Y25813
Z467
Z467
Y13640
Y13640
M92
M92
Y13654
Y13654
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies