Top » Catalog » J2 » S12459

$18.00

S12459
[S12459]

S12459
hg38 Position: ChrY:9924848..9924848
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream Z7671
Forward Primer: S12459_F ATCTGGTAGTTTACTGCTGGAAAATAAGCTG
Reverse Primer: S12459_R CAACAGTAAACTATTGGACAAATATGTC
Reviews

Customers who bought this product also purchased
Z467
Z467
Y13640
Y13640
M92
M92
Y13654
Y13654
J2a-M67 Panel
J2a-M67 Panel
Y11202
Y11202
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32683
1 x Y14436
1 x Y20339
1 x L283
1 x PH3882
1 x FGC5911
1 x A11792
$126.00
Haplogroup Info
Other products
Currencies