Top » Catalog » J2 » S15439

$18.00

S15439
[S15439]

S15439
hg38 Position: ChrY:11975567..11975567
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2a1 (not listed)
Comments: Downstream FGC16096
Forward Primer: S15439_F GCATTGCCTGAAAAGTAGGG
Reverse Primer: S15439_R TCCTGTGTGCCATTCACTTC
Reviews

Customers who bought this product also purchased
DYS388
DYS388
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21091
1 x FGC17782
1 x Y14569
1 x FGC35458
1 x BY32808
1 x Y7694
1 x HU206
1 x FGC20419
1 x A19101
1 x A23313
1 x A19151
1 x FGC35491
$216.00
Haplogroup Info
Other products
Currencies