Top » Catalog » J2 » S18579

$18.00

S18579
[S18579]

S18579
hg38 Position: ChrY:14518218..14518218
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream M319
Forward Primer: S18579_F CAGGGTTTGTGCTCAGATCTAC
Reverse Primer: S18579_R TGGTGGCAGAGATTACCTTTC
Reviews

Customers who bought this product also purchased
PF5197
PF5197
M319
M319
S18910
S18910
L24
L24
Z6065
Z6065
S17487
S17487
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies