Top » Catalog » J2 » S18579

$18.00

S18579
[S18579]

S18579
hg38 Position: ChrY:14518218..14518218
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream M319
Forward Primer: S18579_F CAGGGTTTGTGCTCAGATCTAC
Reverse Primer: S18579_R TGGTGGCAGAGATTACCTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21091
1 x FGC17782
1 x Y14569
1 x FGC35458
1 x BY32808
1 x Y7694
1 x HU206
1 x FGC20419
1 x A19101
1 x A23313
1 x A19151
1 x FGC35491
1 x A15511
1 x Y20306
1 x SK1382
1 x S12459
1 x A12379
$306.00
Haplogroup Info
Other products
Currencies