Top » Catalog » J2 » Y3640

$18.00

Y3640
[Y3640]

Y3640
hg38 Position: ChrY:20688308..20688308
Ancestral: T
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream Y6964
Forward Primer: Y3640_F TGCTAAGCATTCCACTTTTGG
Reverse Primer: Y3640_R TCAAGCAGATGAATCTCAAAAC
Reviews

Customers who bought this product also purchased
A1540
A1540
M67
M67
Y7801
Y7801
M12
M12
CTS6804
CTS6804
L24
L24
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19092
1 x Y16947
1 x SK1368
1 x A22313
1 x A24018
1 x S399
1 x Y16955
1 x Y16904
1 x Y12371
1 x PF4941
1 x FGC22278
1 x HU197
1 x FGC30368
1 x Y13620
1 x A11791
1 x HU213
1 x L254
1 x Y12588
1 x A20725
1 x S18115
1 x A23499
1 x FGC32599
1 x SK1386
1 x Y15187
1 x A19085
$450.00
Haplogroup Info
Other products
Currencies