Top » Catalog » J2 » Y3640

$18.00

Y3640
[Y3640]

Y3640
hg38 Position: ChrY:20688308..20688308
Ancestral: T
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream Y6964
Forward Primer: Y3640_F TGCTAAGCATTCCACTTTTGG
Reverse Primer: Y3640_R TCAAGCAGATGAATCTCAAAAC
Reviews

Customers who bought this product also purchased
A1540
A1540
Z36450
Z36450
J2-M172 Superclade Panel
J2-M172 Superclade Panel
M67
M67
Y7801
Y7801
M12
M12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies