Top » Catalog » J2 » FGC35005

$18.00

FGC35005
[FGC35005]

FGC35005
hg38 Position: ChrY:19317959..19317959
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream FGC16088
Forward Primer: FGC35005_F GCTCATTTCTTCCCCTTTCC
Reverse Primer: FGC35005_R TTTCAATCCTGCACAACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6752
1 x Y24651
1 x Y17051
1 x S18579
$72.00
Haplogroup Info
Other products
Currencies