Top » Catalog » J2 » PH1601

$18.00

PH1601
[PH1601]

PH1601
hg38 Position: ChrY:12947243..12947243
Ancestral: T
Derived: C
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2b2 (not listed)
Comments: Below M12 > Z584 > CTS3617 > Z38241
Forward Primer: PH1601_F TAGCCTCCCGATTACAGGTG
Reverse Primer: PH1601_R CCTGCTTTTCAACTCAACAGG
Reviews

Customers who bought this product also purchased
Z2432
Z2432
Z40054
Z40054
Z2505
Z2505
L283
L283
Z638
Z638
Z40052
Z40052
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC45075
1 x BZ444
1 x BZ970
1 x BZ2267
1 x BY9800
1 x HU224
$108.00
Haplogroup Info
Other products
Currencies