Top » Catalog » J2 » PH1656

$18.00

PH1656
[PH1656]

PH1656
hg38 Position: ChrY:13215477..13215477
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Below M12 > Z1043
Forward Primer: PH1656_F CTTCGTGGAAGGCTGAAAAG
Reverse Primer: PH1656_R ATGGCAGCAGTCATCAAGTG
Reviews

Customers who bought this product also purchased
PH1553
PH1553
FGC62432
FGC62432
Y92225
Y92225
Y145905
Y145905
PH1080
PH1080
Y12005
Y12005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y14400
$18.00
Haplogroup Info
Other products
Currencies