Top » Catalog » J2 » PH3514

$18.00

PH3514
[PH3514]

PH3514
hg38 Position: ChrY:15809390..15809390
Ancestral: G
Derived: A
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream PH1601
Forward Primer: PH3514_F AAGAAACCCTGGTTGGAAGC
Reverse Primer: PH3514_R CAGCCTGGAAACTAGCCAAC
Reviews

Customers who bought this product also purchased
J2b-M12 Panel
J2b-M12 Panel
Z590
Z590
CTS3617
CTS3617
Z2432
Z2432
Z638
Z638
M241
M241
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L271
1 x M4853
1 x PF7320
1 x SK1333
1 x A24026
1 x A17922
1 x PH2967
1 x S15439
1 x SK1360
1 x S7835.2
1 x A15071
1 x FGC32593
1 x Y12400
1 x Y13346
$252.00
Haplogroup Info
Other products
Currencies