Top » Catalog » J2 » CTS1225

$18.00

CTS1225
[CTS1225]

CTS1225
hg38 Position: ChrY:7414210..7414210
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS1225_F CTTGCTCTGTCACCCATGG
Reverse Primer: CTS1225_R ATAAACAAAAATGAACTCATGAGATATATATG
Reviews

Customers who bought this product also purchased
Z6253
Z6253
ZS6172
ZS6172
Y20492
Y20492
Z6257
Z6257
Z467
Z467
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies