Top » Catalog » J2 » CTS1225

$18.00

CTS1225
[CTS1225]

CTS1225
hg38 Position: ChrY:7414210..7414210
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS1225_F CTTGCTCTGTCACCCATGG
Reverse Primer: CTS1225_R ATAAACAAAAATGAACTCATGAGATATATATG
Reviews

Customers who bought this product also purchased
Z6257
Z6257
Z467
Z467
M67
M67
L26
L26
J2-M172 Superclade Panel
J2-M172 Superclade Panel
FGC20254
FGC20254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15073
1 x A12472
1 x Y12600
1 x Y15202
1 x PH890
$90.00
Haplogroup Info
Other products
Currencies