Top » Catalog » J2 » FGC21419

$18.00

FGC21419
[FGC21419]

FGC21419
hg38 Position: ChrY:13887708..13887708
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream S25258 > SK1336 > SK1335
Forward Primer: FGC21419_F GAACTGGAGGAAGGAATGCTC
Reverse Primer: FGC21419_R GTTCCCACCCACGACTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A13639
1 x A6975
1 x BY4526
1 x A7065
$72.00
Haplogroup Info
Other products
Currencies