Top » Catalog » J2 » FGC21419

$18.00

FGC21419
[FGC21419]

FGC21419
hg38 Position: ChrY:13887708..13887708
Ancestral: A
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream S25258 > SK1336 > SK1335
Forward Primer: FGC21419_F GAACTGGAGGAAGGAATGCTC
Reverse Primer: FGC21419_R GTTCCCACCCACGACTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y997
1 x FGC5948
1 x FGC5977
1 x Y9406
1 x AMM116
1 x Y13637
1 x Y993
1 x Y6958
1 x BY18375
1 x BY32799
1 x Y15222
1 x Y16907
$216.00
Haplogroup Info
Other products
Currencies