Top » Catalog » J2 » PF7398

$18.00

PF7398
[PF7398]

PF7398
hg38 Position: ChrY:16806888..16806888
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7398vl_F GAACCTGTTGCAAACTGCAC
Reverse Primer: PF7398vl_R TTGCAAAGATGCTGTCATGC
Reviews

Customers who bought this product also purchased
Z6257
Z6257
Z467
Z467
M67
M67
L26
L26
J2-M172 Superclade Panel
J2-M172 Superclade Panel
FGC20254
FGC20254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30635
1 x FGC52332
1 x FGC35005
1 x HU203
1 x FGC9962
1 x Y14313
1 x SK1361
$126.00
Haplogroup Info
Other products
Currencies