Top » Catalog » J2 » PF7398

$18.00

PF7398
[PF7398]

PF7398
hg38 Position: ChrY:16806888..16806888
Ancestral: A
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7398vl_F GAACCTGTTGCAAACTGCAC
Reverse Primer: PF7398vl_R TTGCAAAGATGCTGTCATGC
Reviews

Customers who bought this product also purchased
Z6253
Z6253
Y20492
Y20492
ZS6172
ZS6172
Z6257
Z6257
Z467
Z467
M67
M67
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies