Top » Catalog » J2 » PF7402

$18.00

PF7402
[PF7402]

PF7402
hg38 Position: ChrY:13305480..13305480
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7402_F TGGAAAAACAATACCCTGAGC
Reverse Primer: PF7402_R CAGGGTTTTTGAGGATGTGG
Reviews

Customers who bought this product also purchased
ZS6172
ZS6172
Y20492
Y20492
Z467
Z467
BY135383
BY135383
FGC63035
FGC63035
FGC45440
FGC45440
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies