Top » Catalog » J2 » PF7402

$18.00

PF7402
[PF7402]

PF7402
hg38 Position: ChrY:13305480..13305480
Ancestral: G
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF7402_F TGGAAAAACAATACCCTGAGC
Reverse Primer: PF7402_R CAGGGTTTTTGAGGATGTGG
Reviews

Customers who bought this product also purchased
Z467
Z467
Y11782
Y11782
FGC45440
FGC45440
FGC20254
FGC20254
CTS900
CTS900
J2a-M67 Panel
J2a-M67 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A15073
1 x A12472
1 x Y12600
1 x Y15202
1 x PH890
1 x CTS7683
1 x Y16930
1 x HU214
1 x A16337
1 x HU224
1 x Y7704
$198.00
Haplogroup Info
Other products
Currencies