Top » Catalog » J2 » SK1335

$18.00

SK1335
[SK1335]

SK1335
hg38 Position: ChrY:15709165..15709165
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1335_F TCTGGTCAACCAGGTTAGGTG
Reverse Primer: SK1335_R TGGGGTTATGAGATTCCAAC
Reviews

Customers who bought this product also purchased
Z482
Z482
CTS900
CTS900
R1a-M458 Panel
R1a-M458 Panel
BY37800
BY37800
Z6272
Z6272
SK1336
SK1336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20437
1 x A11793
1 x CTS1225
1 x PF5196
1 x A5360
1 x Y14375
1 x FGC61398
1 x Y13668
1 x S11868
1 x FGC6758
1 x CTS3617
1 x FGC32142
1 x Y2156
1 x Y22315
1 x FGC6743
1 x A25163
1 x A21931
$306.00
Haplogroup Info
Other products
Currencies