Top » Catalog » J2 » SK1335

$18.00

SK1335
[SK1335]

SK1335
hg38 Position: ChrY:15709165..15709165
Ancestral: G
Derived: A
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1335_F TCTGGTCAACCAGGTTAGGTG
Reverse Primer: SK1335_R TGGGGTTATGAGATTCCAAC
Reviews

Customers who bought this product also purchased
FGC21419
FGC21419
Y16356
Y16356
Z6272
Z6272
SK1336
SK1336
Z482
Z482
CTS900
CTS900
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies