Top » Catalog » J2 » SK1336

$18.00

SK1336
[SK1336]

SK1336
hg38 Position: ChrY:14712338..14712338
Ancestral: T
Derived: C
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1336_F TCTTCCAAATCCAGAAATCG
Reverse Primer: SK1336_R CACAGAAGAGCAAGGACCAG
Reviews

Customers who bought this product also purchased
Y46911
Y46911
Z467
Z467
PH2758
PH2758
M92
M92
SK1335
SK1335
BY37800
BY37800
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies