Top » Catalog » J2 » SK1336

$18.00

SK1336
[SK1336]

SK1336
hg38 Position: ChrY:14712338..14712338
Ancestral: T
Derived: C
Reference: Mark Stoneking and Ryan Wei (2014)
ISOGG Haplogroup: J2a1a1b*
Comments: Equal or downstream M67
Forward Primer: SK1336_F TCTTCCAAATCCAGAAATCG
Reverse Primer: SK1336_R CACAGAAGAGCAAGGACCAG
Reviews

Customers who bought this product also purchased
M92
M92
SK1335
SK1335
BY37800
BY37800
R1a-M458 Panel
R1a-M458 Panel
S25258
S25258
Z6272
Z6272
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies