Top » Catalog » J2 » Y4036

$18.00

Y4036
[Y4036]

Y4036
hg38 Position: ChrY:19984941..19984941
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y4036_F CGCCACACTATCTTCTGCAC
Reverse Primer: Y4036_R GTAATTCTCACGGCCAGCAC
Reviews

Customers who bought this product also purchased
Y16996
Y16996
CTS900
CTS900
Z6270
Z6270
J2a-M67 Panel
J2a-M67 Panel
SK1335
SK1335
S25258
S25258
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC6752
1 x Y24651
1 x Y17051
1 x S18579
1 x A15072
1 x S396
1 x MF10560
1 x CTS7631
1 x Y13511
1 x FGC33131
$180.00
Haplogroup Info
Other products
Currencies