Top » Catalog » J2 » Y4036

$18.00

Y4036
[Y4036]

Y4036
hg38 Position: ChrY:19984941..19984941
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: Y4036_F CGCCACACTATCTTCTGCAC
Reverse Primer: Y4036_R GTAATTCTCACGGCCAGCAC
Reviews

Customers who bought this product also purchased
Z6270
Z6270
Y16996
Y16996
CTS900
CTS900
Z458
Z458
Y23522
Y23522
Z467
Z467
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies