Top » Catalog » J2 » CTS11760

$18.00

CTS11760
[CTS11760]

CTS11760
hg38 Position: ChrY:21093062..21093062
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream M12 > Z1043
Forward Primer: CTS11760_F AAGGGAAGCAGTGAGTGAGC
Reverse Primer: CTS11760_R CCACAACCAGTGTGTTGGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L147.5
1 x FGC32513
1 x Y12619
1 x Y16925
1 x Y13618
1 x L396
1 x Y13894
1 x FGC9927
1 x Y12540
$162.00
Haplogroup Info
Other products
Currencies