Top » Catalog » J2 » CTS8204

$18.00

CTS8204
[CTS8204]

CTS8204
hg38 Position: ChrY:15767113..15767113
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Below M12 > Z2454
Forward Primer: CTS8204_F GACTCATAAGTATTTTTGAAGTATGTGCTG
Reverse Primer: CTS8204_R CAAAATCTCTTGTAGGATAGCCCAC
Reviews

Customers who bought this product also purchased
Z638
Z638
Z1297
Z1297
Y150224
Y150224
M241
M241
Z42942
Z42942
J2b-M12 Panel
J2b-M12 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies