Top » Catalog » J2 » CTS8204

$18.00

CTS8204
[CTS8204]

CTS8204
hg38 Position: ChrY:15767113..15767113
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J2b (not listed)
Comments: Below M12 > Z2454
Forward Primer: CTS8204_F GACTCATAAGTATTTTTGAAGTATGTGCTG
Reverse Primer: CTS8204_R CAAAATCTCTTGTAGGATAGCCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y20900
1 x PAGES00055
1 x S23560
1 x Y15053
1 x FT83405
1 x FGC32141
1 x PF5137
1 x BY55896
1 x Y23522
1 x Y12599
1 x FGC5877
$198.00
Haplogroup Info
Other products
Currencies