Top » Catalog » J2 » FGC15914

$18.00

FGC15914
[FGC15914]

FGC15914
hg38 Position: ChrY:20443527..20443527
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: .
Forward Primer: FGC15914_F TTGAAGAAGACACAAATGACTAAAAAG
Reverse Primer: FGC15914_R GTTCAAAAAGACCATACATTCTGC
Reviews

Customers who bought this product also purchased
Z2222
Z2222
PH1038
PH1038
Y36618
Y36618
L558
L558
PF5197
PF5197
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC21088
1 x SK1326
1 x S5061
1 x A23497
1 x PH878
1 x Y16356
1 x FGC6737
1 x A16360
1 x CTS11760
1 x Y16952
1 x FGC30266
1 x M318
1 x PF7415
1 x FGC21094
1 x FGC16628
1 x PH1656
$288.00
Haplogroup Info
Other products
Currencies