Top » Catalog » J2 » M205

$18.00

M205
[M205]

M205
hg38 Position: ChrY:13475629..13475629
Ancestral: T
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b1
Comments: UTYIntron2a
Forward Primer: M205_F TGGGATCATTCGTTAGCATC
Reverse Primer: M205_R ACAGGTATCCACCACCATGC
Reviews

Customers who bought this product also purchased
Y143905
Y143905
Z534
Z534
J2-M172 Superclade Panel
J2-M172 Superclade Panel
Z575
Z575
J2b-M12 Panel
J2b-M12 Panel
M12
M12
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y17027
1 x HU218
1 x S18238
1 x A24022
1 x Y992
1 x A19111
1 x BY188919
1 x HU217
1 x BY45507
1 x Y17001
1 x Y7010
1 x SK1376
1 x SK1359
1 x FGC35702
1 x FGC29950
1 x Y14581
1 x Y14407
1 x FGC30289
1 x Y20554
1 x Y9409
1 x Y17008
1 x Y13667
1 x FGC23229
1 x Y14406
1 x Y16817
$450.00
Haplogroup Info
Other products
Currencies