Top » Catalog » J2 » M205

$18.00

M205
[M205]

M205
hg38 Position: ChrY:13475629..13475629
Ancestral: T
Derived: A
Reference: Underhill et al. 2001
ISOGG Haplogroup: J2b1
Comments: UTYIntron2a
Forward Primer: M205_F TGGGATCATTCGTTAGCATC
Reverse Primer: M205_R ACAGGTATCCACCACCATGC
Reviews

Customers who bought this product also purchased
L93
L93
Y22079
Y22079
PH4306
PH4306
YP13
YP13
Y22063
Y22063
Y22082
Y22082
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies